On the Subject of DNA Mutation

GATCGATTCGATCGATGCTAGC…

You must gather the mutation numbers that you will use. Do the following steps below for each mutation number:

  • Mutation Numbers 1-6: Use the character shown in Serial Number in the given position. If the character is a letter, convert it to its alphabet position (A = 1, Z = 26). Modulo the number by 4, then add 1.
  • Mutation Numbers 7: Count the number of batteries in the bomb. Modulo the number by 4, then add 1.
  • Mutation Numbers 8: Count the number of indicators in the bomb. Modulo the number by 4, then add 1.
  • Mutation Numbers 9: Count the number of ports in the bomb. Modulo the number by 4, then add 1.

On the top display, it will show 9 nucleotides with different colors. For each letter/color in a given position, locate the intersection in the table below. This is your given nucleic acid. Depending on the position you used, gather the mutation number the matches the same position you used previously. Based on its number, locate the Nth appearing nucleotide on the given nucleic acid.

Guanine Cytosine Adenine Thymine
Red GACT CGAT TCGA GATC
Yellow ACGT TGCA CTAG ATCG
Green GTAC ATGC GCTA TGAC
Blue CGTA TACG CATG GCAT

After gathering all 9 nucleotides, sort each nucleotide based on its position number and connect them into a nucleic acid. This is your mutated nucleic acid.

After you have gathered the mutated nucleic acid, make some changes to each nucleotide. Determine the colors of each DNA strand in a given position and use its color to determine what changes need to apply:

  • Red: The nucleotide retains
  • Green: Change it to the nucleotide it connects to
  • Blue: Change it to the other nucleotide of the same class
  • Yellow: Change it to the other nucleotide of the same class that it connects to
Nucleotide Class Connects to...
G Purine C
C Pyrimidine G
A Purine T
T Pyrimidine A

After performing the changes, if the numbers on the side of the top display is similar to the bottom one, submit the gathered nucleic acid backwards.

After inputting 9 nucleotides, the module will automatically submit. If the sequence was incorrect, the module will strike and 9 colored nucleotides will return.